View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_high_28 (Length: 351)
Name: NF11582_high_28
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 52 - 269
Target Start/End: Original strand, 11467929 - 11468146
Alignment:
| Q |
52 |
tcaactaagcaaatgcaattccaaggcttgtttggttaaaggagtacagaatcataatcatgatttagaaaagaaatgtaacaaatcagttttgtgatca |
151 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11467929 |
tcaattaagcaaatgcaattccaaggcttgtttggttaaaggagtacagaatcataatcatgatttagaaaagaaatgtaacaaatcagttttgtgatca |
11468028 |
T |
 |
| Q |
152 |
tcctcggcaatatccacatcctaagctcaatttcacgtgtagttgccatactcagcaaccctggaaaatagtattctagtctaaattgtactagcaagca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11468029 |
tcctcggcaatatccacatcctaagctcaatttcacgtgtagttgccatactcagcaaccctggaaaatagtattttagtctaaattgtactagcaagca |
11468128 |
T |
 |
| Q |
252 |
acatgagcatgtgaacat |
269 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
11468129 |
acatgagcatgtgaacat |
11468146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University