View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_high_40 (Length: 284)
Name: NF11582_high_40
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_high_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 14 - 180
Target Start/End: Original strand, 31064654 - 31064822
Alignment:
| Q |
14 |
agatgtagagatgtgaaacaagatacatgtgagattgatcccacaagctacaggacacaaa--cgaaaatatttttctaattcattaatatgaacagtga |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31064654 |
agatgtagagatgtgaaacaagatacaggtgagattgatcccacgagctacaggacacaaaaacgaaaatatttttctaattcattaatatgaacagtga |
31064753 |
T |
|
| Q |
112 |
gatttattaactttaagttttagatttggtgtaagtcacgtgaaaatatagccaccgaagattgaccgg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31064754 |
gatttattaactttaagttttagatttggtgtaagtcacgtgaaaatatagccaccgaagattgaccgg |
31064822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University