View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_high_52 (Length: 246)
Name: NF11582_high_52
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_high_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 35246882 - 35247094
Alignment:
| Q |
18 |
tatgcaacaggtgacattacaagagtatgcttcacttgagctattaagttcatccttctctcgaattcatgcttcgaaatcccccaatccttgatcctct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35246882 |
tatgcaacaggtgacattacaagagtatgcttcacttgagctattaagttcatccttctctcgaattcatgcttcgaaatcccccaatccttgatcctct |
35246981 |
T |
 |
| Q |
118 |
taacagccaaaagcacaccattatctagcataactttgtataggcttccatgttttcctctcctaatcaattcagcaggagcacttaacaagtcctcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35246982 |
taacagccaaaagcacaccattatctagcataactttgtataggcttccatgttttcctctcctaatcaattcagcaggagcacttaacaagtcctcaaa |
35247081 |
T |
 |
| Q |
218 |
ttgcaatccccta |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35247082 |
ttgcaatccccta |
35247094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University