View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_high_54 (Length: 244)
Name: NF11582_high_54
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 17738352 - 17738130
Alignment:
| Q |
7 |
tgaactaaactagttcggctccgttcaattcatgatttatcg-atgatttatcaacggagttcagtttagtaattaagtttttataaatagtcctaattt |
105 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||| ||||||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
17738352 |
tgaactaaactagttcgactccattcaattcatgatttatcggatgatttatcaacggaattcagtttaataattaggtttttataaatagttctaattt |
17738253 |
T |
 |
| Q |
106 |
tcgattgatcataaaaccacattttgannnnnnnnnnnnnnaaaaagttatttatggttttgttcggaatcatggatctgatgcaccaaacaataataac |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17738252 |
tcgattgatcataaaaccacattttgatttttttttttttt--taagttatttatggttttgttcggaatcatggatctggtgcaccaaacaataataac |
17738155 |
T |
 |
| Q |
206 |
atttcggttcagaatacatctttat |
230 |
Q |
| |
|
| |||||||||| |||||||||||| |
|
|
| T |
17738154 |
aattcggttcaggatacatctttat |
17738130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University