View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_high_57 (Length: 239)
Name: NF11582_high_57
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38884185 - 38883970
Alignment:
| Q |
1 |
ttacccttggtcaaactctagattactagaatcccttcctgttagaactggcaggtgaagacacaaaaagacatgaagagaaaatgatagtagtttgaac |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38884185 |
ttaccgttggtcaaactctagattactagaatcccttcccatgagaactggcaggtgaagacacaaaaagacatgaagaaaaaatgatagtagtttgaa- |
38884087 |
T |
|
| Q |
101 |
tttgaagaatcactaacctgtgttggaaacttacaggtgttgatgcagataccaacacacttgctttcctccagatacttgcatctttcaacatgcacct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38884086 |
------gaatcactaacctgtgttggaaacttacaggtgttgaggcagataccaacacacttgctttcctccagatacttgcatctttcaacatgcacct |
38883993 |
T |
|
| Q |
201 |
acaacattttatagtacataaac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38883992 |
acaacattttatagtacataaac |
38883970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University