View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11582_high_58 (Length: 239)

Name: NF11582_high_58
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11582_high_58
NF11582_high_58
[»] chr2 (1 HSPs)
chr2 (1-56)||(8520157-8520212)


Alignment Details
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 8520157 - 8520212
Alignment:
1 tacatggtcatttgcgatatatagtttttaaaaatcaataacaaacatcttataat 56  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8520157 tacatggtcatttgcgatatatagtttttaaaaatcaataacaaacatcttataat 8520212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University