View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_high_64 (Length: 224)
Name: NF11582_high_64
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_high_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 79 - 205
Target Start/End: Complemental strand, 39887840 - 39887714
Alignment:
| Q |
79 |
tgtgtaatgaatgtagtatgggggtagaagtagatagataataaatgcaaagaaatgattgggcaatgagtaggatgaaaactaatggcacatgaatggc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39887840 |
tgtgtaatgaatgtagtatgggggtagaagtagatagataataaatgcaaagaaatgattgggcaatgagtaggatgaaaactgatggcacatgaatggc |
39887741 |
T |
 |
| Q |
179 |
aagtagcaagtgattagtatgatcatg |
205 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
39887740 |
aagtagcaagtgatttgtatgatcatg |
39887714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University