View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_low_44 (Length: 262)
Name: NF11582_low_44
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 3 - 256
Target Start/End: Complemental strand, 50911601 - 50911334
Alignment:
| Q |
3 |
tatactacgttcatcaaaattcaaatttcagtcaaatctgtcctacttcacttgtgttgaaggcgaatat-----------acagactgtgtgaaaattt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50911601 |
tatactacgttcatcaaaattcaaatttcagtcaaatctgtcctacttcacttgtgttgaaggcgaatatgctgcgaatatacagactgtgtgaaaattt |
50911502 |
T |
 |
| Q |
92 |
gaaacatattttattcaaagnnnnnnn---tgaaacaaattgaagggagtagnnnnnnnnnaggatagttgaacggagtggttattatagattgtgatga |
188 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50911501 |
gaaacatattttattcaaagaagaaaaaaatgaaacaaattgaagggagtagtttttttttaggataattgaacggagtggttattatagattgtgatga |
50911402 |
T |
 |
| Q |
189 |
ttataaagggtatattttattaccattttacgtattattttggtcaatctctctactccctttgctac |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50911401 |
ttataaagggtatattttattaccattttacgtattattttggtcaatctctctactccttttgctac |
50911334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University