View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_low_56 (Length: 241)
Name: NF11582_low_56
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 159
Target Start/End: Complemental strand, 5302438 - 5302297
Alignment:
| Q |
19 |
ctgttgtagtaccaagttcttcaccagatgaaattgtgcatattgaaattgataaaacggataaaaactgattattggttttttcatcaagatcctgcat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5302438 |
ctgttgtagtaccaagttcttcaccagatgaaattgtacatattgaaattgataaaacggataaaaactgattattggttttttcatcaagatcctgcat |
5302339 |
T |
 |
| Q |
119 |
tgtaagcagaaa-taaataaaacttgtatgaatgtgttgcta |
159 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5302338 |
tgtaagcagaaattaaataaaacttgtatgaatgtgttgcta |
5302297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 198 - 241
Target Start/End: Complemental strand, 5302298 - 5302255
Alignment:
| Q |
198 |
tattgtattatctcaatcaaaaaatggaagaaagaaaaggcctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5302298 |
tattgtattatctcaatcaaaaaatggaagaaagaaaaggcctg |
5302255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 29222450 - 29222342
Alignment:
| Q |
19 |
ctgttgtagtaccaagttcttcaccagatgaaattgtgcatattgaaattgataaaacggataaaaactgattattggttttttcatcaagatcctgcat |
118 |
Q |
| |
|
|||| |||||||||| |||||||||| |||| | ||| ||| |||| |||||||| | ||||||||||||||| |||||| ||||| ||||| ||| |
|
|
| T |
29222450 |
ctgtcgtagtaccaacttcttcaccaaatgagagtgtacatcttgatgttgataaatctgataaaaactgatta----ttttttaatcaaaatcctacat |
29222355 |
T |
 |
| Q |
119 |
tgtaagcagaaat |
131 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
29222354 |
tgtaagctgaaat |
29222342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University