View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11582_low_63 (Length: 226)
Name: NF11582_low_63
Description: NF11582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11582_low_63 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 5 - 217
Target Start/End: Complemental strand, 41614696 - 41614484
Alignment:
| Q |
5 |
gagttaagacaatatgcgaaataaagaaaagacacatcattttttgttgcaaaagatgaaaaagaaatacaaataattgtaatttgtattcgtacaaaaa |
104 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
41614696 |
gagttaaaaaaatatgcgaaataaagaaaagacacatcattttttattgcaaaagatgaaaaagaaatacaaatgattgtcatttgtattcgtacaaaaa |
41614597 |
T |
|
| Q |
105 |
atattgatgaaactatgtatggcttgctcnnnnnnnnnnnnnnnnnnnnnnctatgtacgggttgcattttgcattgcaagtcgcacaaccttcgttgtt |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
41614596 |
atattgatgaaactatgcatggcttgctcaaaaaaagaaggaaaaagaaaactatgtacgggttgcattttgcattgcaagtcgcacgacctccgttgtt |
41614497 |
T |
|
| Q |
205 |
atctttgcctttg |
217 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
41614496 |
atctttgcgtttg |
41614484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University