View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11583_high_4 (Length: 243)
Name: NF11583_high_4
Description: NF11583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11583_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 6587425 - 6587639
Alignment:
| Q |
16 |
ctttccacctgagaaatcgaatactgaattcaataaacatgatcgattcgatacattattgttaatttacaattgatgatttggtagaaataaaaacctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587425 |
ctttccacctgagaaatcgaatactgaattcaaataacatgatcgattcgatacattattgttaatttacaattgatgatttggtagaaataaaaacctt |
6587524 |
T |
|
| Q |
116 |
gaaggagagaaacaacttttttggagagagattcgtcatcaacatcacaattatctgatcccgaagcttcatcgcgatcttcttcatcatcttcctcatc |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587525 |
gaaggagagaaacaactttttcggagagagattcgtcatcaacatcacaattatctgatcccgaagcttcatcgcgatcttcttcatcatcttcctcatc |
6587624 |
T |
|
| Q |
216 |
ttcaatttcacaggt |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6587625 |
ttcaatttcacaggt |
6587639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University