View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11583_low_5 (Length: 254)
Name: NF11583_low_5
Description: NF11583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11583_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 6587749 - 6587983
Alignment:
| Q |
1 |
cctctcctctcatccannnnnnngtagctgtaattgtatttgcagacacgccgcggtatttattcgtgtaaaaatatttgaaattgaaatgaaacaagca |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6587749 |
cctctcctctcatccatttttttgtagctgtaattgtatttgcagacacgccgcggtatttattcgtgtaaaaatatttgaaattgaaatgaaacaagca |
6587848 |
T |
 |
| Q |
101 |
tagag-aaagagcggctctaggcctgagcttaattcatccctttttctatcaaaaatcaataatctctttagtnnnnnnntaaaggttaaattagaccgg |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
6587849 |
tagagaaaagagcggctctaggcctgagcttaattcatccctttttctataaaaaatcaataatctctttagtaaaaaaataaaggttaaattagatcgg |
6587948 |
T |
 |
| Q |
200 |
gagtcttttcggtttgaggtttgtaatagatcggt |
234 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
6587949 |
aagtctttttagtttgaggtttgtaatagatcggt |
6587983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University