View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11584_high_26 (Length: 298)
Name: NF11584_high_26
Description: NF11584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11584_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 14 - 281
Target Start/End: Complemental strand, 36604197 - 36603930
Alignment:
| Q |
14 |
cataggatatatctaccctggatatcctgtagctaacatgtgcttcaaggtttatggttacattagtatgacacaagccatcactttcttgcaagacttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604197 |
cataggatatatctaccctggatatcctgtagctaacatgtgcttcaaggtttatggttacattagtatgacacaagccatcactttcttgcaagacttc |
36604098 |
T |
 |
| Q |
114 |
aaactaggccactacatgaaaatccctcctagaaccatgttcatggcacaggcttgtcccactaccaaatattcgaatcagaattgtctgcggcccgcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
36604097 |
aaactaggccactacatgaaaatccctcctagaaccatgttcatggcacaggtttgtcacactaccaaatattcaaatcagaattgtctgcggcccacaa |
36603998 |
T |
 |
| Q |
214 |
tttgatgcatttatgcaattagcacatatgtgattgttcgatgaagatcaaatgatctaaacttcaag |
281 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
36603997 |
tttgacgcatttatgcaattagcacatatgtgatcgttagatgaagatcaaatgatctaaacttcaag |
36603930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University