View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11584_high_34 (Length: 239)
Name: NF11584_high_34
Description: NF11584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11584_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 29007108 - 29007303
Alignment:
| Q |
21 |
gacacaaacacatgcatcaggatattgacaatg-tacaattcactgatacgttttcgatcacaagtgtcggtgctcttgacgtgtcgattgcaca--aca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29007108 |
gacacaaacacatgcatcaggatattgaaaatgatacaattca--gatacgttttcgatcacaagtgtcggtgctcttgacgtgtcgattgcacagcaca |
29007205 |
T |
|
| Q |
118 |
caagaaaacgtgtttaagctgaattataagttataatcgaagtgtatttattgtgtaaatgttgttgattacatttgcatttgaattgtacagggttg |
215 |
Q |
| |
|
||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29007206 |
caaaaaaatgtgtttaagctgaattataagttataatcgaagtgtatttattgtgtaaatgttgttgattgcatttgcatttgaattgtacagggttg |
29007303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University