View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11584_high_39 (Length: 204)
Name: NF11584_high_39
Description: NF11584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11584_high_39 |
 |  |
|
| [»] scaffold0206 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 43 - 188
Target Start/End: Original strand, 22519289 - 22519431
Alignment:
| Q |
43 |
tttgatgaatgtgatttcgttgttgcatgtatcaaataattagagatagagaaataagtttcatattattaagtatatgagtataaaacctgactttaaa |
142 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22519289 |
tttgatgaatgtgattttgttgttgcatgtatcaaataattagagatagagaaataagtttcatattattaaatatatgagtataaaacctgactttaaa |
22519388 |
T |
 |
| Q |
143 |
agcctttaatttgttgttgatgttgttgctgcatgtgtgaaagaag |
188 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22519389 |
agcctttaatttgttgt---tgttgttgctgcatgtgtgaaagaag |
22519431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0206 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0206
Description:
Target: scaffold0206; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 189
Target Start/End: Complemental strand, 15153 - 14998
Alignment:
| Q |
35 |
ttttttcctttgatgaatgtgatttcgttgttgcatgtatcaaataattaga----gatagagaaataagtttcatattattaagtatatgagtataaaa |
130 |
Q |
| |
|
||||||||||| || ||| ||||| ||||||||||||||||||||| || | ||| |||||| | |||||||| |||||| |||||| ||||||| |
|
|
| T |
15153 |
ttttttcctttaataaatatgattg-gttgttgcatgtatcaaataaataaatagtgatgaagaaatcaatttcatataattaaggatatgaatataaaa |
15055 |
T |
 |
| Q |
131 |
cctgactttaaaagcctttaatttgttgttgatgttgttgctgcatgtgtgaaagaagt |
189 |
Q |
| |
|
||||| |||||| ||||| ||||||||||| | | ||| |||||||||||||||||| |
|
|
| T |
15054 |
gctgaccttaaaaacctttgatttgttgttgttat--ttgttgcatgtgtgaaagaagt |
14998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 37 - 81
Target Start/End: Original strand, 5321816 - 5321860
Alignment:
| Q |
37 |
ttttcctttgatgaatgtgatttcgttgttgcatgtatcaaataa |
81 |
Q |
| |
|
||||||||| || |||||||||| ||||||||||||||||||||| |
|
|
| T |
5321816 |
ttttcctttaataaatgtgatttggttgttgcatgtatcaaataa |
5321860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University