View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11584_low_15 (Length: 395)
Name: NF11584_low_15
Description: NF11584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11584_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 14 - 381
Target Start/End: Complemental strand, 4261452 - 4261085
Alignment:
| Q |
14 |
gatggacatctgggatgggctaattcagtggcattaacgctggccgggattacaaacataactgacagtccaagaggaggaactatagtgaggacaggtg |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261452 |
gatggacatatgggatgggctaattcagtggcattaacgctggccgggattacaaacataactgacagtccaagaggaggaactatagtgaggacaggtg |
4261353 |
T |
|
| Q |
114 |
gtggaggtaataatttattatccaaatgtcaatagaatgaggtcaatttctaaacaatataagtctatgcttggttaggccttccttcaagtgatttggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261352 |
gtggaggtaataatttattatccaaatgtcaatagaatgaggtcaatttctaaacaatataagtctatgcttggttaggccttccttcaagtgatttggg |
4261253 |
T |
|
| Q |
214 |
attattctttaatttttgccgtcacttttttgtatatcattatcttcgattaaactttcttcattttgacttcatgaatcttcattcattaacttggact |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261252 |
attattctttaatttttgccgtcacttttttgtatatcattatcttcgattaaactttcttcattttgacttcatgaatcttcattcattaacttggact |
4261153 |
T |
|
| Q |
314 |
gtgaactttgagtttctgcattttatgattgttttctatgattgttttctggataatgttgtcaattg |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4261152 |
gtgaactttgagtttctgcattttatgattgttttctatgattgttttctggataatgttgtcaattg |
4261085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University