View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11584_low_38 (Length: 222)
Name: NF11584_low_38
Description: NF11584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11584_low_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 38892391 - 38892601
Alignment:
| Q |
13 |
aggagcacagaaagcaacaacaaaccaattacctatgattataagcgatggagacatcatatcttcgctaaaaaccttaaaacatta-tgtatatatgtc |
111 |
Q |
| |
|
|||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
38892391 |
aggagcacggaaagcaacagcgaaccaattacctatgattataagcgatggagacatcatatcttcgctcaaaaccttaaaacattaatgtgtatatgtc |
38892490 |
T |
 |
| Q |
112 |
acatctcatatatattcaacgttttgtctattcataattgatgtagaactaatcactcaaacttaaatccaacaatttgaaatctcacttttcacttgtc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38892491 |
acatctcatatatattcaacgttttgtctattcataattgatgtagaattaatcactcaaacttaatcccaacaatttgaaatctcacttttcacttgtc |
38892590 |
T |
 |
| Q |
212 |
tctcttctctg |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
38892591 |
tctcttctctg |
38892601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University