View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11585_high_24 (Length: 309)
Name: NF11585_high_24
Description: NF11585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11585_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 296
Target Start/End: Original strand, 40521720 - 40521997
Alignment:
| Q |
18 |
tcaatgaagattgtctttgctgttctgcatcatcatctctgtcctttattttcacaagaaagaaagnnnnnnnngtgaggataaggctttatgttcatgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40521720 |
tcaatgaagattgtctttgctgttctgcatcatcatctctgtcctttattttcacaagaaagaaagaaaaaaaagtgaggataaggctttatgttcatgc |
40521819 |
T |
|
| Q |
118 |
tatagtaatcggaggatacaatatattatgataactcttgccagtgtaacaatctgacaaatgaaatatacatcaaacaaaattttagttctgtttggtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40521820 |
tatagtaatcggaggatacaatatattatgataactcttgccagtgtaataatctgacaaatgaaatatacatcaaacaaaattttagttctgtttggtt |
40521919 |
T |
|
| Q |
218 |
tgagataacgttcgctattttcatttcgtactcttattttttaattgcaaaattacctcttcttttcattatgtttcct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40521920 |
tgagataacgttcgctattttcatttcgtactctta-tttttaattgcaaaattacctcttcttttcattatgtttcct |
40521997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University