View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11585_high_34 (Length: 243)
Name: NF11585_high_34
Description: NF11585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11585_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 3760916 - 3760704
Alignment:
| Q |
16 |
aagaacaagtggtagcaca--atctgcaagttaatggggatatgtaaatttcaaaataggaacaagaatttagaatgnnnnnnnntaaagaaagagataa |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3760916 |
aagaacaagtggtagcacacaatctgcaagttaatggggatatgtaaatttcaaaataggaacaagaatttagaatgaaaaaaaataaagaaagagataa |
3760817 |
T |
 |
| Q |
114 |
agcaaaagctttagtcttggatcactttctctattctcattttcccatggatgaagatctgcctttgcctttaccatcagcatcaaacccttctcactca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3760816 |
agcaaaagctttagtcttggatcactttctctattctcattttcccatggatgaagatctgcctttgcctttaccatcagcatcaaacccttctcactca |
3760717 |
T |
 |
| Q |
214 |
gtttgcttgtgat |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3760716 |
gtttgcttgtgat |
3760704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University