View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11585_low_11 (Length: 429)
Name: NF11585_low_11
Description: NF11585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11585_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 27821675 - 27821962
Alignment:
| Q |
19 |
gaagcttggaaccaaaaaccttctcttttgccctctgacccttacaaacgatcacaagccaagttttggggagattacattgacaaacatgtaagttact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27821675 |
gaagcttggaaccaaaaaccttctcttttgccctcggacccttacaaacgatcacaagccaagttttggggagattacattgacaaacatgtaagttact |
27821774 |
T |
 |
| Q |
119 |
tacattactatgtgtgttattatttttggttagtcgtgctattggtgtgaagtatccagcacctttgtcagactaatttccgccggag-ttatagctagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27821775 |
tacattactatgtgtgttattatttttggttagtcgtgctattggtgtgaagtatccagcacctttgtcagactaatttccgccggagattatagctagc |
27821874 |
T |
 |
| Q |
218 |
cacttttagtgggtttccactctcaactacattttttcgtccatattaatacttaagtagatacatatgtatgaaataacatccgttg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27821875 |
cacttttagtgggtttccactctcaactacattttttcgtccatattaatacttaagtagatacatatgtatgaaataacatccgttg |
27821962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 27824655 - 27824752
Alignment:
| Q |
19 |
gaagcttggaaccaaaaaccttctcttttgccctctgacccttacaaacgatcacaagccaagttttggggagattacattgacaaacatgtaagtta |
116 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27824655 |
gaagcttggaatcacaaaccttctcttttgcccttagacccttacaagcgatcacaagctaagttttggggagattacattgacaaacatgtaagtta |
27824752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 354 - 416
Target Start/End: Original strand, 27822011 - 27822073
Alignment:
| Q |
354 |
gtagatttgagttcaaccataaatagtgtaccatatttggtctaacactatattatttgatct |
416 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27822011 |
gtagatttgagttcaaccataaaaagtgtaccatatttggtctaacactatattatttgatct |
27822073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University