View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11585_low_21 (Length: 334)
Name: NF11585_low_21
Description: NF11585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11585_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 41 - 324
Target Start/End: Original strand, 26759007 - 26759291
Alignment:
| Q |
41 |
aagatgctaagctagtccacctaaatcagcatcagagaaaatcgcatctgagactttaagaagaaacaaattttaaggtctcaaatcaacagaccagcga |
140 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
26759007 |
aagatgctaagctagtctacttaaatcagcatcggagaaaatcacatctgagattttaagaagaaacaaattttaagatctcaaaccaacagaccagcga |
26759106 |
T |
|
| Q |
141 |
tagctcaagtgagttatatttatggtatttttacaactgtttctaagatattttgtacaaagttaaactcttatcgtttaatctgacttcctatttcatc |
240 |
Q |
| |
|
|| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26759107 |
taactcaagtgggttatacttatggtatttttacaactgtttctaagatattttgtacaaagttaaactcttatcgtttaatctgacttcctatttcatc |
26759206 |
T |
|
| Q |
241 |
tatcaacc-aaaaaaggatggagaatatgattgttttgcccctgaaacattcagagtgcattcactcattaaatgtgccttcatc |
324 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
26759207 |
tatcaaccaaaaaaaggatgaagaatatgattgttttgcccctgagacattcagagtgccttcactcattaaacgtgccttcatc |
26759291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University