View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11585_low_27 (Length: 290)
Name: NF11585_low_27
Description: NF11585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11585_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 2458503 - 2458782
Alignment:
| Q |
1 |
tagccttgttgtcaaacaaaatggtgttatgcatttctatttcttctcaatgaaacttttaatgaagaagtatatatgtgtcaaccacctgtttttgtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2458503 |
tagccttgttgtcaaacaaaatggtgttatgcatttctatttcttctcaatgaaacttttaatgaagaagtatatatgtctcaaccacctgtttttgtgt |
2458602 |
T |
|
| Q |
101 |
atcaaatatacatacgatctaattatgtttgcatgcttcaaaggtctctttatggcctcaaggaagctccaaatgcatacactaatatatatgtggccat |
200 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2458603 |
atcaaatatacatac--tctaattatatttgcatgcttcaaaagtctctttatggcctcaacgaagctccaaatgcatacactaatatatatgtggccat |
2458700 |
T |
|
| Q |
201 |
aaagacaatattaattgtggcctattttgttgtctatgttgatgatttacttttcaacggtaactccttcaattttcatctc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2458701 |
aaagacaatattaattgtggcctattttgttgtctatgttgatgatttacttttcaacggtaacaccttcaattttcatctc |
2458782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University