View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11585_low_35 (Length: 242)
Name: NF11585_low_35
Description: NF11585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11585_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 149
Target Start/End: Original strand, 41655682 - 41655816
Alignment:
| Q |
15 |
agcataggcaaaataggggtaggatgaatggccatgcagtatcacagggaaatactcactctggtacatatatgccacaagcccagcaggcttctcagtc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41655682 |
agcataggcaaaataggggtaggatgaatggccatgcagtatcacagggaaatactcactctggtacatatatgccacaagcccagcaggcttctcagtc |
41655781 |
T |
|
| Q |
115 |
agcgatctcttcaagagagtcaagtactcagcagg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41655782 |
agcgatctcttcaagagagtcaagtactcagcagg |
41655816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 221
Target Start/End: Original strand, 41655841 - 41655888
Alignment:
| Q |
174 |
cgagccccacttttcacttagagaacatgtaaatgcttatgcattgca |
221 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
41655841 |
cgagccccacttctcacttatagaacatgtaaatgcttatgcgttgca |
41655888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University