View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11585_low_36 (Length: 239)
Name: NF11585_low_36
Description: NF11585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11585_low_36 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 47958290 - 47958067
Alignment:
| Q |
16 |
atttctaacaaaatatcgtatatttggatgatacttgattaaaagtatttttagaagtgtagtataaagtaaaatagtaaatgaaatctctcagaaaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47958290 |
atttctaacaaaatatcgtatatttggatgatacttgattaaaagtatttttagaagtgtagtataaagtaaaatagtaaatgaaatctctcagaaaaca |
47958191 |
T |
 |
| Q |
116 |
aaacctggttaagtcaaagaccacttacttacctatatttggctctaaattcacttggcaaacttcaaacggaacatgataattctatctcaactttagc |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47958190 |
aaacttggttaagtcaaagaccacttacttacctatatttggctctaaattcacttggcaaacttcaaacggaacatgataattctatctcaactttagc |
47958091 |
T |
 |
| Q |
216 |
ttttaaatgtacagttaacaatcc |
239 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
47958090 |
ttttaaatatacagttaacaatcc |
47958067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University