View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11585_low_38 (Length: 233)
Name: NF11585_low_38
Description: NF11585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11585_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 79 - 225
Target Start/End: Original strand, 47957840 - 47957986
Alignment:
| Q |
79 |
ctatacttattttgtgtgcctaaattaggaaatttagaaaagtagacaatcttgaaactaaaatgaatgatatcatcattcttcagaggatgaatgatat |
178 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47957840 |
ctatactttttttgtgtgcctaaattaggaaatttagaaatgtagacaatcttgaaactaaaatgaatgatatcatcattcttcacaggatgaatgatat |
47957939 |
T |
 |
| Q |
179 |
catcatattcacggtcattccgagtcaacaatactaattgctggaag |
225 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
47957940 |
catcatattcacggtcattcggagttaacaatactaattgctggaag |
47957986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University