View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11586_low_4 (Length: 265)
Name: NF11586_low_4
Description: NF11586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11586_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 49 - 254
Target Start/End: Complemental strand, 37489211 - 37489006
Alignment:
| Q |
49 |
aactcttcgatcaatccttcaacataatggttctgttagatatcttcaatctttgaataataacaaaagtgttgatcctgctactttcacaagtcttgtt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37489211 |
aactcttcgatcaatccttcaacataatggttctgttagatatcttcaatctttgaataataacaaaagtgttgatcctgctactttcacaagtcttgtt |
37489112 |
T |
 |
| Q |
149 |
cctttgtcttcctatgatgattacgttgactttatccaccagatggctgatggagaacatgatgatcatcatgatcttctctctgttgatcctcttctct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37489111 |
cctttgtcttcctatgatgattacgttgactttatccaccagatggctgatggagaacatgatgatcatcatgatcttctctctgttgatcctcttctct |
37489012 |
T |
 |
| Q |
249 |
gcttct |
254 |
Q |
| |
|
|||||| |
|
|
| T |
37489011 |
gcttct |
37489006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University