View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11587_low_9 (Length: 283)
Name: NF11587_low_9
Description: NF11587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11587_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 269
Target Start/End: Complemental strand, 520191 - 519953
Alignment:
| Q |
19 |
tgttttgttttatatgattaatt-aatttagttgaaaggtgcagtgcatgtgtgtggagagaggacattaattaaaatattgaatatgcaagtatagatc |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
520191 |
tgttttgttttatatgattaatttaatttagttgaaaggtgca-----tatatgtggagagaggacattaattaaaatattgaatatgcaagtatagatc |
520097 |
T |
 |
| Q |
118 |
ctactcacttttgatttgatcatatatttattaattaatgaaactcttttgtttatagttattgtcaaagttacgtgcaatgcattggtgctgtctgtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
520096 |
ctactcacttttgatttgatcatatatt----aattaatgaaactcttttgtttatagttattgtcaaagttacgtgcaatgcattggtgctgtctgtga |
520001 |
T |
 |
| Q |
218 |
cacacacatggtaccatccatgcacatggagagtttttcattctccaaggtt |
269 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
520000 |
cacacacatggta----ccatgcacatggagagtttttcattctccaaggtt |
519953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University