View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11588_high_10 (Length: 216)
Name: NF11588_high_10
Description: NF11588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11588_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 13 - 165
Target Start/End: Complemental strand, 7377039 - 7376887
Alignment:
| Q |
13 |
ctgatgatccaactaccatccccttttctaaccagacgaccaaagtctattcgaatcgtcatgacaacaaccatcggccttcaaaataaaaccatccaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7377039 |
ctgatgatccaactaccatccccttttctaaccagacgaccaaaatctattcgaatcgtcatgacaacaaccatcggccttcaaaataaaaccatccaga |
7376940 |
T |
 |
| Q |
113 |
caaaagggtaccaggaaatccatccagaaggattattggcatgggctataaat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7376939 |
caaaagggtaccaggaaatccatccagaaggattattggcatgggctataaat |
7376887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University