View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11588_low_10 (Length: 216)

Name: NF11588_low_10
Description: NF11588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11588_low_10
NF11588_low_10
[»] chr2 (1 HSPs)
chr2 (13-165)||(7376887-7377039)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 13 - 165
Target Start/End: Complemental strand, 7377039 - 7376887
Alignment:
13 ctgatgatccaactaccatccccttttctaaccagacgaccaaagtctattcgaatcgtcatgacaacaaccatcggccttcaaaataaaaccatccaga 112  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7377039 ctgatgatccaactaccatccccttttctaaccagacgaccaaaatctattcgaatcgtcatgacaacaaccatcggccttcaaaataaaaccatccaga 7376940  T
113 caaaagggtaccaggaaatccatccagaaggattattggcatgggctataaat 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
7376939 caaaagggtaccaggaaatccatccagaaggattattggcatgggctataaat 7376887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University