View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11588_low_5 (Length: 314)
Name: NF11588_low_5
Description: NF11588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11588_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 4885034 - 4885338
Alignment:
| Q |
1 |
tactgttactgttaccgttacttctactgttgtttgttaatattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885034 |
tactgttactgttaccgttacttctactgttgtttgttaatattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtg |
4885133 |
T |
 |
| Q |
101 |
attatttttatccggtggtggcggtgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttagga |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885134 |
attatttttatccggtggtggcggcgtagggagaggcatgaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttagga |
4885233 |
T |
 |
| Q |
201 |
acaactccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgattt |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885234 |
acaacaccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgattt |
4885333 |
T |
 |
| Q |
301 |
cttct |
305 |
Q |
| |
|
||||| |
|
|
| T |
4885334 |
cttct |
4885338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University