View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11589_high_13 (Length: 291)
Name: NF11589_high_13
Description: NF11589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11589_high_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 10 - 291
Target Start/End: Original strand, 25423640 - 25423923
Alignment:
| Q |
10 |
aggagcacagaagacaatttcgaaaaaagcggattccctgcaatgaaattcattcaggcgtcaaaactcatgagtaactaccaatacaagcacaataatc |
109 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25423640 |
aggatcactgaagacaatttcgaaaaaagcggattccctgcaatgaaattcattcaggcgtcaaaacttatgagtaactaccaatacaagcacaataatc |
25423739 |
T |
 |
| Q |
110 |
taaggtagtataaaaatcaaatgatacagtggctcaagggaatgaaaaattacctgcaacgcaaaagtaatatcaccttcatctagttttggtgtcactc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25423740 |
taaggtagtataaaaatcaaatgatacagtggctcaagggaatgaaaaattacctgcaacgcaaaagtaatatcaccttcatctagttttggtgtcactc |
25423839 |
T |
 |
| Q |
210 |
ttctcaatttatcatctcgggattgtcctagtttaataaggccctgcagtaataatttatg--tatcattatattactgttcac |
291 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
25423840 |
ttctcaatttatcatctctggattgtcctagtttaataaggccctgcagtaataatttatgtatatcattatattactgatcac |
25423923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University