View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11589_high_24 (Length: 236)
Name: NF11589_high_24
Description: NF11589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11589_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 45725459 - 45725671
Alignment:
| Q |
1 |
agacttctgtactgtttatgtcatatctaaggggaaaatctcttcagttcggaatgcttctcgtgcagcaccacatacctctcctcttctcaaccatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725459 |
agacttctgtactgtttatgtcatatctaaggggaaaatctcttcagttcggaatgcttctcgtgcagcaccacatacctctcctcttctcaaccatata |
45725558 |
T |
|
| Q |
101 |
cataacaatctaactagtgaggatgtaaatcaaactgcacagcagatatgctctagacgtatgaatatgagaggtttgtttgcttatgtaaattaaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725559 |
cataacaatctaactagtgaggatgtaaatcaaactgcacagcagatatgctctagacgtatgaatatgagaggtttgtttgcttatgtaaattaaaaga |
45725658 |
T |
|
| Q |
201 |
actaagctattta |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45725659 |
actaagctattta |
45725671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University