View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11589_high_27 (Length: 233)
Name: NF11589_high_27
Description: NF11589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11589_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 35027184 - 35026983
Alignment:
| Q |
14 |
gcataggtgctggatattagttttaccctatagagtttttggttcgataaatannnnnnngtatattaaaaaagaggtgtgtttgcgtatgtttgggtga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35027184 |
gcataggtgctggatattagttttaccctatagagtttttgattcgataaatatttttttgtatattaaaaaagaggtgtgtttgcgtatgtttgggtga |
35027085 |
T |
|
| Q |
114 |
gcgtttggccaccaccaagggacagtgacataccttttcacggtgattttctaagctacaaagtgtagcttccacgtcagtgaggtgttctgccgcagtt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35027084 |
gcgtttggccaccaccaagggacagtgacgtaccttttcacggtgattttctaagctacaaagtgtagcttccacgtcaatgaggtgttctgccgcagtt |
35026985 |
T |
|
| Q |
214 |
ct |
215 |
Q |
| |
|
|| |
|
|
| T |
35026984 |
ct |
35026983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 35023437 - 35023392
Alignment:
| Q |
13 |
agcataggtgctggatattagttttaccctatagagtttttggttc |
58 |
Q |
| |
|
||||||| ||||||||| |||||| | ||||||||||||||||||| |
|
|
| T |
35023437 |
agcatagatgctggatactagtttcatcctatagagtttttggttc |
35023392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 36862636 - 36862715
Alignment:
| Q |
134 |
gacagtgacataccttttcacggtgattttctaagctacaaagtgtagcttccacgtcagtgaggtgttctgccgcagtt |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||| |||||| |
|
|
| T |
36862636 |
gacaatgacataccttttcacggtgattttctaagctacaaagagtagcttccaggtcaatgaggtgttctgctgcagtt |
36862715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 36862532 - 36862586
Alignment:
| Q |
13 |
agcataggtgctggatattag-ttttaccctatagagtttttggttcgataaata |
66 |
Q |
| |
|
||||||||||||| ||| ||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
36862532 |
agcataggtgctgaatactaggttttatcctatagagtttttggttcgataaata |
36862586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University