View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11589_low_16 (Length: 291)
Name: NF11589_low_16
Description: NF11589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11589_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 38609646 - 38609397
Alignment:
| Q |
1 |
caggttgatattgtcttcgtatgcatttttgaaaaactgctttaatttgttgattctttgtatttttcaaaaatatcgtatgtaacttgtttgccaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38609646 |
caggttgatattgtcttcgtatgcatttttgaaaaactgccttaatttgttgattctttgtatttttcaaaaatatcgtatgtaacttgtttgccaaaaa |
38609547 |
T |
 |
| Q |
101 |
tatcgtatgtaacttgtttgtcatattaccttttttacatttatgaatgcactaatcatgtctcacagggcccaaaaatacatgcggagatccacaaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38609546 |
tatcgtatgtaacttgtttgtcactataccttttttacatttatgaatgcactaatcatgtctcacagggcccaaaaatacatgcggagatccacaaaaa |
38609447 |
T |
 |
| Q |
201 |
tgggcatgggcttggtcaggtgagtcgtggaggatcctctgctacttcaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
38609446 |
tgggcatgggcttggtcaggtgagtcatggaggatcatctgctacttcaa |
38609397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University