View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11589_low_19 (Length: 253)

Name: NF11589_low_19
Description: NF11589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11589_low_19
NF11589_low_19
[»] chr7 (1 HSPs)
chr7 (94-245)||(34254608-34254759)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 94 - 245
Target Start/End: Complemental strand, 34254759 - 34254608
Alignment:
94 acaacgacgttaaagctaatcttcgcagattcacttcccgctttccttctcctatcgccaaggataatcgtggttggattcttgatcctattgctctcgc 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34254759 acaacgacgttaaagctaatcttcgcagattcacttcccgctttccttctcctatcgccaaggataatcgtggttggattcttgatcctattgctctcgc 34254660  T
194 actttcttccaccatttcaggtggagctgttacttgtgcttctcttcttctc 245  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||| ||||    
34254659 actttcttccatcatttcaggtggagctgttacttgtgcttctcttcatctc 34254608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University