View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11589_low_19 (Length: 253)
Name: NF11589_low_19
Description: NF11589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11589_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 94 - 245
Target Start/End: Complemental strand, 34254759 - 34254608
Alignment:
| Q |
94 |
acaacgacgttaaagctaatcttcgcagattcacttcccgctttccttctcctatcgccaaggataatcgtggttggattcttgatcctattgctctcgc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34254759 |
acaacgacgttaaagctaatcttcgcagattcacttcccgctttccttctcctatcgccaaggataatcgtggttggattcttgatcctattgctctcgc |
34254660 |
T |
 |
| Q |
194 |
actttcttccaccatttcaggtggagctgttacttgtgcttctcttcttctc |
245 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34254659 |
actttcttccatcatttcaggtggagctgttacttgtgcttctcttcatctc |
34254608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University