View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11589_low_22 (Length: 244)
Name: NF11589_low_22
Description: NF11589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11589_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 25423904 - 25424126
Alignment:
| Q |
1 |
atcattatattactgatcaccactttgcctcaagaaagccctctaatataaaaattatttagtggcaaaaactatatcaagaaattcatgacagatacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25423904 |
atcattatattactgatcaccactttgcctcaagaaagcactctaatataaaaattatttagtggcaaaaactatatcaagaaattcatgacagatacct |
25424003 |
T |
 |
| Q |
101 |
gatcatttaacactctgcacatgtttgaaaattccatgattccagcagggggaattagtgatgatttgcatatctccgcataagatttatataactcgcc |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25424004 |
ggtcatttaacactctgcacatgtttgaaaattccatgattccagcagggggaattagtgatgatttgcatatctccgcataagatttatataactcgcc |
25424103 |
T |
 |
| Q |
201 |
aaggattgagtctttcttggctc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25424104 |
aaggattgagtctttcttggctc |
25424126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University