View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_15 (Length: 501)
Name: NF1158_high_15
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 226 - 432
Target Start/End: Complemental strand, 33718926 - 33718720
Alignment:
| Q |
226 |
ctcttcagggaagaaattgcatcctaaacatcctgctatgttgcattcgcggcaggtttccatgttcgttggtggaattcgctccatgctgctgctgctt |
325 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718926 |
ctcttgagagaagaaattgcatcctaaacatcctgctatgttgcattcgcggcaggtttccatgttcgttggtggaattcgctccatgctgctgctgctt |
33718827 |
T |
|
| Q |
326 |
ccgatggtggaatccgggagatgaaattccggtaatgagtttgcggttgaggtggagccggagatgactttggttagggcggtgacaatgacggattgtt |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718826 |
ccgatggtggaatccgggagatgaaattccggtaatgagtttgcggttgaggtggagccggagacgactttggttagggcggtgacaatgacggattgtt |
33718727 |
T |
|
| Q |
426 |
cttgatc |
432 |
Q |
| |
|
||||||| |
|
|
| T |
33718726 |
cttgatc |
33718720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 226 - 292
Target Start/End: Complemental strand, 33720930 - 33720864
Alignment:
| Q |
226 |
ctcttcagggaagaaattgcatcctaaacatcctgctatgttgcattcgcggcaggtttccatgttc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||| |
|
|
| T |
33720930 |
ctcttcagggaagaaattgcatcctaaacatcctgctatgttgcattcccgacaggtttctatgttc |
33720864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 226 - 279
Target Start/End: Complemental strand, 33735593 - 33735540
Alignment:
| Q |
226 |
ctcttcagggaagaaattgcatcctaaacatcctgctatgttgcattcgcggca |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33735593 |
ctcttcagggaagaaattgcatcctaaacatcctgctatgttgcattcccggca |
33735540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 226 - 302
Target Start/End: Complemental strand, 33750399 - 33750323
Alignment:
| Q |
226 |
ctcttcagggaagaaattgcatcctaaacatcctgctatgttgcattcgcggcaggtttccatgttcgttggtggaa |
302 |
Q |
| |
|
|||||| |||||||||| ||||||||| |||||||| ||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
33750399 |
ctcttctgggaagaaatcgcatcctaagcatcctgcaatgttgcattcctggcaggtttctatgttcgcaggtggaa |
33750323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 86; Significance: 7e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 101 - 202
Target Start/End: Complemental strand, 8507891 - 8507790
Alignment:
| Q |
101 |
gtccaaatctccgttcgtaaagatatctaaacctcctattgatttgtctagtctactccttgctcatgcatggggtgtagcatttgttaggaagtagtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||| |||||| |
|
|
| T |
8507891 |
gtccaaatctccgttcgtaaagatatctaaacctcctattgatttgtctagtctactccttgatgatgcatggggtgtaggatttgttaggaactagtct |
8507792 |
T |
|
| Q |
201 |
cc |
202 |
Q |
| |
|
|| |
|
|
| T |
8507791 |
cc |
8507790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 31017316 - 31017257
Alignment:
| Q |
138 |
attgatttgtctagtctactccttgctcatgcatggggtgtagcatttgttaggaagtag |
197 |
Q |
| |
|
|||||||||| |||| | ||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
31017316 |
attgatttgtatagtgtgctccttgcttatgcatgaggtgtagcatttgttagggagtag |
31017257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University