View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_31 (Length: 375)
Name: NF1158_high_31
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_31 |
 | |
|
| [»] scaffold1099 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold1099 (Bit Score: 131; Significance: 7e-68; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 241 - 375
Target Start/End: Complemental strand, 2196 - 2062
Alignment:
| Q |
241 |
gagttgttaaactagtcttcagctggtgggtttccttcttgttcctggccttgagctgtcttggattaggcctgtgctccagtccaattgttcaatcgtt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2196 |
gagttgttaaactagtcttcagctggtgggtttccttcttgttcctgggcttgagctgtcttggattaggcctgtgctccagtccaattgttcaatcgtt |
2097 |
T |
|
| Q |
341 |
ccttatttccattcaaggttaggctatcaaaccct |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096 |
ccttatttccattcaaggttaggctatcaaaccct |
2062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 143 - 228
Target Start/End: Complemental strand, 53680425 - 53680340
Alignment:
| Q |
143 |
catattaagaagttacaaaataatatcaatattaacttgaatttgaaataataccaagaagaaatagaagtagtgatcacaattca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53680425 |
catattaagaagttacaaaataatatcaatattaacttgaatttgaaataataccaagaagaaatagaagtagttatcacaattca |
53680340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 30 - 97
Target Start/End: Complemental strand, 53680509 - 53680443
Alignment:
| Q |
30 |
ataccaacattatgtagactagttgtggataatttagtctcttttaaacatgtgatcaatgtttttat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53680509 |
ataccaacattatgtagactagttgtggataatttagtctcttttaaacat-tgatcaatgtttttat |
53680443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University