View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_35 (Length: 360)
Name: NF1158_high_35
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 260
Target Start/End: Original strand, 45167270 - 45167519
Alignment:
| Q |
9 |
accacagacaacaaagggtccggtccatttgacagaacagccaaagctggatggatttcttagatttagatgcgtggggtttttattttctcctttctca |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45167270 |
accacagacaacaaagggtc-----catttgacagaacagccaaagctggatggatttcttagatttagatgcgtgggatttttattttctcctttctca |
45167364 |
T |
 |
| Q |
109 |
ctaattttgaactattgaccgataatggtactgctactttttctcaattgccatgcctaatgttgtctaggtaagtgtctggttgaaacttgtttgtctt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45167365 |
ctaattttgaactattgaccgataatggtactactactttttctcaattgccatgcctaatgtcgtctaggtaagtgtctggttgaaacttgtttgtctt |
45167464 |
T |
 |
| Q |
209 |
ttttaacttgtcc---gatagagtaatgtctcactctcaactttcctttttagct |
260 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45167465 |
ttttaacttgtccgatgatagagtaatgtctcactctcaactttcctttttagct |
45167519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University