View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_41 (Length: 331)
Name: NF1158_high_41
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_41 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 29 - 331
Target Start/End: Complemental strand, 8126990 - 8126693
Alignment:
| Q |
29 |
aactatgaacaaagaaaataataccaaagatttgttgataaccaatccgatgattacttgtgagataattgtgtaaatttatgggtaacttaacctttan |
128 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8126990 |
aactacgaacaaagaaaataataccaaagatttgttgataaccaatccgatgattacttgtgagataattgtgtaaatttatgggtaacttaacctttat |
8126891 |
T |
 |
| Q |
129 |
nnnnnnataggtgaatacaacttttccattaaaatttatttttaattcccatttaggagggaagaggaatattacttgcttgcttgcttcatatatttct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| | |||||| |
|
|
| T |
8126890 |
ttttt-ataggtgaatacaacttttccattaaaatttatttttaattcccaattaggagggaagaggaatattacttgctt----gcttgcttcatttct |
8126796 |
T |
 |
| Q |
229 |
ataaaccccatttgatttataaaataataatttgtggggattcatttaatttctttaagcaactagctacaaaaaatcataaagtattcaaaactcaatg |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8126795 |
ataaaccccatttgatttataaaataataatttgtggggattcatttaatttctttaagcaactagctacaaaaaatcataaagtattcaaaactcaatg |
8126696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University