View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_54 (Length: 310)
Name: NF1158_high_54
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 44 - 302
Target Start/End: Original strand, 43091583 - 43091841
Alignment:
| Q |
44 |
caatttgaccatagctgtcatgcatgtgtagaatagtttttatctacaccgacacaattatagaaccaaagcaccaataaacaaactgaaaaataccata |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091583 |
caatttgaccatagctgtcatgcatgtgtagaatagtttttatctacaccgacacaattatagaaccaaagcaccaataaacaaactgaaaaataccata |
43091682 |
T |
 |
| Q |
144 |
atgaatctcaacccttgatttaatccattaactccattttcatcatcagcagctttctgatcatcagaatctgcatctgcatctggtccatctgccggtg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091683 |
atgaatctcaacccttgatttaatccattaactccattttcattatcagcagctttctgatcatcagaatctgcatctgcatctggtccatctgccggtg |
43091782 |
T |
 |
| Q |
244 |
agtctgcatcctcatccgccgccggcgccgccttcttcttcttggctttactctctgct |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43091783 |
agtctgcatcctcatccgccgccggcgccgccttcttcttcttggctttactctttgct |
43091841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University