View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_56 (Length: 307)
Name: NF1158_high_56
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 47 - 294
Target Start/End: Complemental strand, 45763601 - 45763360
Alignment:
| Q |
47 |
tcttcctcctcagattccactgttttaccgacaactccacctgaagcgccggagaataagtctaactcccattccagcagtgagagttccagcctcaccg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763601 |
tcttcctcctcagattccactgttttaccgacaactccacctgaagcgccggagaataagtctaactcccattccagcagtgagagttccagcctcaccg |
45763502 |
T |
 |
| Q |
147 |
ccgctgcggtgactgaaacggtttcagaaccaacgccactgccggagaagaaaatcaacaaaggttttgagaatgattcactggaacaaggaacaggtga |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763501 |
ccgctgcggtgactgaaacggtttcagaa------ccaccgccggagaagaaaatcaacagaggttttgagaatgattcactggaacaaggaacaggtga |
45763408 |
T |
 |
| Q |
247 |
ttgtggtatattctcagagatcgcaactttcacaagcttgatcacttc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763407 |
ttgtggtatattctcagagatcgcaactttcacaagcttgatcacttc |
45763360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University