View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_65 (Length: 266)
Name: NF1158_high_65
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 89 - 223
Target Start/End: Original strand, 55095177 - 55095311
Alignment:
| Q |
89 |
gctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatctactatcaggtaattaacctttctcttttta |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095177 |
gctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatctactatcaggtaattaacctttctcttttta |
55095276 |
T |
 |
| Q |
189 |
ttattatgtaatgtctaattaatgtgtgtgttagt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095277 |
ttattatgtaatgtctaattaatgtgtgtgttagt |
55095311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 29 - 83
Target Start/End: Original strand, 5657073 - 5657127
Alignment:
| Q |
29 |
aatataaagactatagtactgatttatacctattcatccattcatattaattaag |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5657073 |
aatataaagactatagtactgatttatacctattcatccattcatattaattaag |
5657127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 159
Target Start/End: Complemental strand, 28896877 - 28896807
Alignment:
| Q |
89 |
gctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatcta |
159 |
Q |
| |
|
|||||| |||| || ||| ||||||||||||| |||||| | ||||||| |||||| |||||||||||||| |
|
|
| T |
28896877 |
gctgtttctgatattggttctgctcttggtttacctgctaaaggcactaatcctgattctgatcacatcta |
28896807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University