View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_68 (Length: 261)
Name: NF1158_high_68
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 40 - 244
Target Start/End: Original strand, 32989842 - 32990046
Alignment:
| Q |
40 |
tgcttttgggacaggtccgtggttacggacatagtggagtgggacaggtgtaatgaaaccatgttctactagttcttgaagtggtggctctgagttgaag |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32989842 |
tgcttttgggacaggtccgtggttacggacatagtggagtgggacaggtgtaataaaaccatgttctactagttcttgaagtggtggctctgagttgaag |
32989941 |
T |
 |
| Q |
140 |
gggtgttttcctgtcagacggagcattgaggtgttccgtttgatccattgatcagaggtcccagcgtcgcgtggatcaaagattgatggttctagttctg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32989942 |
gggtgttttcctgtcagacggagcattgaggtgttccgtttgatccattgatcagaggtcccagcgtcgcgtggatcaaagattgatggttctagttctt |
32990041 |
T |
 |
| Q |
240 |
tggtg |
244 |
Q |
| |
|
||||| |
|
|
| T |
32990042 |
tggtg |
32990046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University