View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1158_high_79 (Length: 250)

Name: NF1158_high_79
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1158_high_79
NF1158_high_79
[»] chr3 (1 HSPs)
chr3 (116-240)||(55448130-55448254)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 116 - 240
Target Start/End: Original strand, 55448130 - 55448254
Alignment:
116 cacatattaattactaaattgacggggattgaaaaagaaaatgacggaattgagatgagaagtggaggaagagcagagcagcagagatctagctagtaaa 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
55448130 cacatattaattactaaattgacggggattgaaaaagaaaatgacggaattgagatgagaagtggaggaagagcagagcagcagagatctagttagtaaa 55448229  T
216 tagtaataaacatctttccttcatc 240  Q
    |||||||||||||||||||||||||    
55448230 tagtaataaacatctttccttcatc 55448254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University