View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_high_85 (Length: 209)
Name: NF1158_high_85
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_high_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 29 - 163
Target Start/End: Original strand, 55095177 - 55095311
Alignment:
| Q |
29 |
gctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatctactatcaggtaattaacctttctcttttta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095177 |
gctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatctactatcaggtaattaacctttctcttttta |
55095276 |
T |
|
| Q |
129 |
ttattatgtaatgtctaattaatgtgtgtgttagt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095277 |
ttattatgtaatgtctaattaatgtgtgtgttagt |
55095311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 29 - 99
Target Start/End: Complemental strand, 28896877 - 28896807
Alignment:
| Q |
29 |
gctgttgctgacatcggtgctgctcttggtttgcctgctcagggcactactcctgactctgatcacatcta |
99 |
Q |
| |
|
|||||| |||| || ||| ||||||||||||| |||||| | ||||||| |||||| |||||||||||||| |
|
|
| T |
28896877 |
gctgtttctgatattggttctgctcttggtttacctgctaaaggcactaatcctgattctgatcacatcta |
28896807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University