View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_106 (Length: 214)
Name: NF1158_low_106
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 49918877 - 49918714
Alignment:
| Q |
1 |
atgagactgcacattgccaacctcacaatccacgtcctttttt-attggcctaaagtatgggtgttaccctttctttgaaatgattgatttgataccctt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49918877 |
atgagactgcacattgccaacctcacaatccacgtcctttttttattggcctaaagtatgggcgttaccctttctttgaaatgattgatttgataccctt |
49918778 |
T |
 |
| Q |
100 |
aggggtatatgtgcacattcaatgaatatgtgtatgtcagtatggggtcttggattatttttgt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
49918777 |
aggggtatatgtgcacattcaatgaatatgtgtatatcagtatggggtcttcgattatttttgt |
49918714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University