View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_109 (Length: 211)
Name: NF1158_low_109
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_109 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 26 - 160
Target Start/End: Complemental strand, 55095311 - 55095177
Alignment:
| Q |
26 |
actaacacacacattaattagacattacataataataaaaagagaaaggttaattacctgatagtagatgtgatcagagtcaggagtagtgccctgagca |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095311 |
actaacacacacattaattagacattacataataataaaaagagaaaggttaattacctgatagtagatgtgatcagagtcaggagtagtgccctgagca |
55095212 |
T |
|
| Q |
126 |
ggcaaaccaagagcagcaccgatgtcagcaacagc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55095211 |
ggcaaaccaagagcagcaccgatgtcagcaacagc |
55095177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 52580426 - 52580474
Alignment:
| Q |
163 |
gggcttggatcagatggtgcatttgcgacgtaggagggatgaatctgac |
211 |
Q |
| |
|
||||||||| ||| |||||||||| ||||| |||||||||||||||||| |
|
|
| T |
52580426 |
gggcttggaccagctggtgcatttccgacggaggagggatgaatctgac |
52580474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 90 - 160
Target Start/End: Original strand, 28896807 - 28896877
Alignment:
| Q |
90 |
tagatgtgatcagagtcaggagtagtgccctgagcaggcaaaccaagagcagcaccgatgtcagcaacagc |
160 |
Q |
| |
|
|||||||||||||| |||||| ||||||| | |||||| ||||||||||||| ||| || |||| |||||| |
|
|
| T |
28896807 |
tagatgtgatcagaatcaggattagtgcctttagcaggtaaaccaagagcagaaccaatatcagaaacagc |
28896877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University