View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_11 (Length: 554)
Name: NF1158_low_11
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 453; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 453; E-Value: 0
Query Start/End: Original strand, 30 - 545
Target Start/End: Complemental strand, 2097572 - 2097057
Alignment:
| Q |
30 |
aatttgaccttatggctcattgttttctttgttattctttacattaactatcaaaatcaaaacctatttgtagctgcacctcgtgacgaggaagctgcaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097572 |
aatttgaccttatggctcattgttttctttgttattctttacattaactatcaaaatcaaaacctatttgtagctgcacctcgtgacgaggaagctgcaa |
2097473 |
T |
|
| Q |
130 |
ctcttgccgaggcagtggcatctggcagcaagctggaagtagaagtaggtttacagaagtttgatgtcaatgggagcagccgtgagctgggttggatcag |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2097472 |
ctcttgccgaggtagtggcatctggcagcaagctggaagtagaagtaggtttacagaagtttgatgtcaatgggagcagccgtgacctgggttggatcag |
2097373 |
T |
|
| Q |
230 |
cgacccaggctttgacaccgatggcgaaagcagggttgattgatttggaggagaacatggagacggatgctagctagaaatagagtcaattctgaagatt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097372 |
cgacccaggctttgacaccgatggcgaaagcagggttgattgatttggaggagaacatggagacagatgctagctagaaatagagtcaattctgaagatt |
2097273 |
T |
|
| Q |
330 |
aatcatgtgggagtttcaaaggctctttatctgaaggagtttttgaggnnnnnnnnacgagttttaggtctaagaaaaaccaaggtttggtctggc-ttt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
2097272 |
aatcatgtgggagtttcaaaggctctttatctgaaggagtttttga-gttttttttacgagtcttaggtctaagaaaaaccaaagtttggtctggctttt |
2097174 |
T |
|
| Q |
429 |
agtttggcacgttgttgtgtggaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggttctctctga |
528 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097173 |
agtttggcacgttgttgtgtgaaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggttctctctga |
2097074 |
T |
|
| Q |
529 |
tgttgggggttctgtgg |
545 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2097073 |
tgttgggggttctgtgg |
2097057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University