View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1158_low_112 (Length: 204)
Name: NF1158_low_112
Description: NF1158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1158_low_112 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 20633227 - 20633132
Alignment:
| Q |
1 |
agatttaatgtaacttccggtccgaaattcattcgccttcatttctacccttattcttatttggacttcaacatctcaaaagctttcttttctgtc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20633227 |
agatttaatgtaacttccggtccgaaattcattcgccttcatttctaccctttttcttatttggacttcaacatctcaaaagctttcttatctgtc |
20633132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 20649326 - 20649231
Alignment:
| Q |
1 |
agatttaatgtaacttccggtccgaaattcattcgccttcatttctacccttattcttatttggacttcaacatctcaaaagctttcttttctgtc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
20649326 |
agatttaatgtaacttccggtccgaaattcattcgccttcatttctaccctttttcttatttgaatttcaatatctcaaaagctttcttatctgtc |
20649231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University